Journal of the Pancreas Open Access

Keywords

Diabetes Mellitus, Non-Insulin- Dependent; Diabetic Nephropathies; India; Peptidyl-Dipeptidase A; Polymorphism (Genetics)

Abbreviations

TTP: thymidine 5-triphosphate

INTRODUCTION

South Asian type 2 diabetic patients have been shown to have a higher prevalence of nephropathy when compared to Europeans [1, 2].

ACE polymorphism appears to have a significant impact on the progression of diabetic nephropathy [3]. Several Japanese studies have found the D allele to be an independent risk factor for diabetic nephropathy [4]. It is important to look for the gene association in the Asian Indian population, in view of the high prevalence of diabetic nephropathy and to see whether the association differs from other populations. To our knowledge, there have been no studies on ACE gene polymorphism in the native Indian population.

METHODS

Patients

The study was carried out in 109 South Indian type 2 diabetic patients (72 males and 37 females; age 56.7±9.0 years, mean±SD). Inclusion criteria were: patient age greater than or equal to 30 years, duration of type 2 diabetes greater than or equal to 5 years. Patients not on oral hypoglycemic agents and/or with congestive cardiac failure were excluded from the study.

Eighty-six of these 109 patients were consecutive cases with nephropathy referred as outpatients at the hospital during a 7-month period. These patients were selected on the basis of:

· presence of persistent proteinuria greater than or equal to 500 mg/dL;

· presence of hypertension;

· presence of diabetic retinopathy;

· normal urine microscopy.

In addition, 23 patients with normoalbuminuria, normal urine microscopy and absence of both hypertension and retinopathy were studied. Normoalbuminuria was defined on the basis of an albumin excretion rate less than or equal to 30 mg/mg creatinine in early morning urine samples using the immunoturbidimetry method for albumin. These patients were selected from the outpatients treated in the hospital in the same time period.

Data on the duration of the diabetes, blood pressure, prevalence of hypertension, glycosylated hemoglobin (HbA1) and body mass index (BMI, Kg/m2) were recorded for each patient.

DNA Isolation and Determination of ACE Genotype

Genomic DNA was isolated from peripheral blood leukocytes according to published protocols for extracting DNA from human nucleated cells [5]. To determine the ACE genotype, genomic DNA was amplified by PCR [6] initially using a flanking primer pair and subsequently when necessary, with a primer pair that recognizes the insertion specific sequences for confirmation of the specificity of the amplification reactions.

The flanking primer pair used was 5’CTGGAGACCACTCCCATCCTTTCT3’ and 5’GATGTGGCCATCACATTCGTCACGAT3’. Amplification with this primer pair results in 490 bp and 190 bp amplification products corresponding to the I and D alleles, respectively. PCR amplification used 25 mL reactions (0.5 mg genomic DNA, 200 pmol of each primer, 0.5 mM each of deoxy-ATP, GTP, CTP, thymidine 5-triphosphate (TTP), 3 mM MgCl2, 1 unit of Taq DNA polymerase (Perkin- Elmer, Norwalk, CT, USA), 0.001% gelatin and 10 mM Tris-HCl, pH 8.3) with 10 min. denaturation at 94 oC, followed by 30 cycles of one min. at 94 oC, one min. at 58 oC (annealing) and two min. at 72 oC (extension) in a thermal cycler. PCR products were detected on a 2% agarose-gel containing ethidium bromide.

Mistyping of ID heterozygotes as D homozygotes may occur due to the preferential amplification of the D allele and inefficiency in the amplification of the I allele [7]. To increase the specificity of DD genotyping, PCR amplifications were also performed with an insertion specific primer pair (5’TGGGACCACAGCGCCCGCCACTAC3’ and 5’TCGCCAGCCCTCCCATGCCCATAA3’) in all samples that were found to be DD after amplification with the flanking primers. Briefly, insertion-specific amplification was performed using 25 mL reactions (0.5 mg genomic DNA, 200 pmol of each primer, 0.5 mM each of deoxy-ATP, GTP, CTP, TTP, 3 mM MgCl2, 0.5 units of Taq DNA polymerase, 0.001% gelatin and 10 mM Tris-HCl, pH 8.3) with one min. denaturation at 94 oC, followed by 30 cycles of 30 sec. at 94 oC, 45 sec at 67 oC (annealing), and two min. at 72 oC (extension). Under these conditions, only the I allele produced a 335 bp amplicon. The 335 bp fragment was identified on 2% agarose-gel containing ethidium bromide. The reaction yields no products in samples of DD genotype.

ETHICS

The study was approved by the ethical committee of the Diabetes Research Centre of Madras. Informed oral consent was obtained from each patient.

STATISTICS

Data are reported as mean ± standard deviation (SD). Statistical comparisons between group means were done by the unpaired Student t-test, while proportions were compared by means of the Yates’ corrected chi-squared test (c2). The odds ratio (OR), together with the 95% confidence interval (CI), comparing the allelic distributions in the two study groups were also calculated. Two-tailed P values less than 0.05 were considered significant. The SPSS/PC+ 4.01 package was used to perform statistical analyses.

RESULTS

As shown in Table 1, the two study groups were well-matched for gender, age, body mass index (BMI), duration of both diabetes and hypertension, and HbA1 values. Nephropathic patients had significantly higher systolic and diastolic blood pressure values.

Table 2 shows the ACE genotype distribution in nephropathic and normoalbuminuric patients. Among the total patients, 27 (24.8%) patients had the II genotype, while the ID genotype was present in 53 patients (48.6%) and the DD genotype in 29 patients (26.6%). In nephropathic patients, the ID and DD genotypes were present in 52.3% and 27.9% of patients, respectively, as compared to 34.8% and 21.7% in normoalbuminuric patients. Total D allele was present with a significantly higher prevalence (c2=4.28, P=0.039) in nephropathic patients (80.2%) than in normoalbuminuric patients (56.5%); therefore, the percentage of II genotype was higher in normoalbuminuric patients (43.5%) as compared to the nephropathic patients (19.8%). According to these prevalence values, the odds ratio (OR) related to the association of the D allele with nephropathy was 3.12 (95% CI: 1.17-8.32). No significant differences between nephropathic and normoalbuminuric patients were observed as far as the distribution of the ID and DD alleles within the total D class were concerned (c2=0.00, P=1.000). Taking into account nephropathic patients only, the severity of proteinuria, as well as the blood levels of urea and creatinine, were not significantly related to the different genotypes (considering II, ID, and DD alleles, respectively: proteinuria: 1,940+1,401, 2,017+1,632, and 1,965+1,603 mg/dL; urea 43+31, 38+14, and 38+17 mg/dL; creatinine 1.3+1.0, 1.1+0.6, and 1.1+0.6 mg/dL).

DISCUSSION

This study demonstrated a positive association between the D allele (ID and DD genotype) of the ACE polymorphism and diabetic nephropathy in South Indian type 2 diabetic patients. Several Japanese studies had also found the D allele to be an independent risk factor for diabetic nephropathy in type 2 diabetic patients [4, 6, 8]. The odds ratio noted in our study for the association of D allele with nephropathy (OR=3.12) was comparable to the report of Ohno et al. [8] (OR=2.6) and Yoshida et al. [6] (OR=4.6) in similar analyses. Jeffers studied 509 type 2 Caucasian diabetic patients and found the DD genotype to be an independent risk factor for diabetic nephropathy with an OR equal to 2.8 [9].

A meta analysis showed that patients who were homozygous for the deletion allele (DD genotype) had a rapid decline in renal function and the D allele also appeared to be significantly associated with diabetic nephropathy [10]. We did not observe any association between the D allele and severity of nephropathy. This is probably related to the small numbers in each allelic group. Kennon et al. also, in their review of the literature, found a significant association between the DD genotype and diabetic and non-diabetic renal disease [3]. The French and Belgian GENEDIAB study demonstrated that the D allele was associated with both an increased incidence and severity of diabetic nephropathy in a large group of type 1 diabetic patients [11]. We have not studied the distribution of ACE gene polymorphism in the general population. In the diabetic nephropathy group, there was an elevated association with the D allele. This was in keeping with the observations in several populations. Follow-up studies of the patients are being carried out to study the relationship of the genotypes with the severity and the rate of decline of kidney function.

Tables at a glance

Table 1 Table 2

References

1. Mather HM, Chaturvedi N, Kehely AM. Comparison of prevalence and risk factors for microalbuminuria in South Asians and Europeans with type 2 diabetes mellitus. Diabet Med 1998; 15:672-7. [98367848]
2. Burden AC, McNally PG, Fee Gally J, Walls J. Increased incidence of end stage renal failure secondary to diabetes mellitus in Asian ethnic groups in the United Kingdom. Diabet Med 1992; 9:641-5. [92380005]
3. Kennon B, Petrie JR, Small M, Connell JMC. Angiotensin-converting enzyme gene and diabetes mellitus. Diabet Med 1999; 60:448-58. [99318275]
4. Doi Y, Yoshzimi H, Yoshinari M, Lion K, Yamamoto M, Ichikawa K, et al. Association between a polymorphism in the angiotensin-converting enzyme gene and microvascular complication in Japanese patients with NIDDM. Diabetologia 1996; 39:97-102.
5. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988; 16:1215.
6. Yoshida H, Kuriyama S, Atsumi Y, Tomonari H, Mitarai T, Hamaguchi A, et al. Angiotensin I converting enzyme gene polymorphism in non-insulin dependent diabetes mellitus. Kidney Int 1996; 50:657-64. [96437652]
7. Shanmugam V, Sell KW, Saha BK. Mistyping of ACE heterozygotes. PCR Methods Appl 1993; 3:120-21.
8. Ohno T, Kawazu S, Tomono S. Association analyses of the polymorphisms of angiotensin-converting enzyme and angiotensinogen genes with diabetic nephropathy in Japanese non-insulin-dependent diabetics. Metabolism 1996; 45:218-22. [96174689]
9. Jeffers BW, Estacio RO, Raynolds MV, Schrier RW. Angiotensin-converting enzyme gene polymorphism in non-insulin dependent diabetes mellitus and its relationship with diabetic nephropathy. Kidney Int 1997; 52:473-7. [97409643]
10. Fujisawa T, Ikegami H, Kawaguchi Y, Hamada Y, Ueda H, Shintani M, et al. Meta-analysis of association of insertion/deletion polymorphism of angiotensin I converting enzyme gene with diabetic nephropathy and retinopathy. Diabetologia 1998; 41:47-53. [98158394]
11. Marre M, Jeunemaitre X, Gallois Y, Rodier M, Chatellier G, Sert C, et al. Contribution of genetic polymorphism in the renin-angiotensin system to the development of renal complications in insulin-dependent diabetes: Genetique de la NephropathieDiabetique (GENEDIAB) study group. J Clin Invest 1997; 99:1585-95. [97248271]