Journal of Infectious Diseases and Treatment Open Access

  • ISSN: 2472-1093
  • Journal h-index: 8
  • Journal CiteScore: 1.06
  • Journal Impact Factor: 0.77
  • Average acceptance to publication time (5-7 days)
  • Average article processing time (30-45 days) Less than 5 volumes 30 days
    8 - 9 volumes 40 days
    10 and more volumes 45 days

Research Article - (2016) Volume 2, Issue 1

Identification to Species Level of Candida parapsilosis Complex into Sites Oral Cavity in a Cohort of Argentinos Patients

Rodrígue L1,3, Rosa A2 and Jewtuchowicz V1

1Department of Microbiology, University of Buenos Aires, Parasitology and Immunology-IMPaM-UBA-CONICET, Federal Capital, CABA, Argentina

2Department of Microbiology and Parasitology, Faculty of Dentistry, University of Buenos Aires, Argentina

3Department of Semiotics and Clinical Diagnostics, Faculty of Dentistry, University of Cuenca, Ecuador

Corresponding Author:
Rodrígue L
Department of Microbiology, Parasitology and Immunology-IMPaM-UBA-CONICET, University of Buenos Aires, Federal Capital, CABA, Argentina.
E-mail: malourdes84@hotmail.com

Received: April 12, 2016; Accepted: April 20, 2016; Published: April 29, 2016

Citation: Rodrígue L, Rosa A, Jewtuchowicz V. Identification to Species Level of Candida parapsilosis Complex into Sites Oral Cavity in a Cohort of Argentinos Patients. J Infec Dis Treat. 2016, 2:1. doi:10.21767/2472-1093.100012

Visit for more related articles at Journal of Infectious Diseases and Treatment

Abstract

Candida parapsilosis is a complex of three species (Cp. sensu stricto, Candida orthopsilosis and Candida methapsilosis) due to genetic heterogeneity. Currently, it is the second most isolated in yeast bloodstream infections in Latin America, Asia and Europe. In Argentina and globally is no data on the distribution and behavior of the species that make up this complex in oral niches. Knowledge becomes important in the event that the mouth can be a potential source of candidemia and / or invasive infections by this yeast in patients with other risk factors source. Objective: To identify to species C. parapsilosis complex in clinical isolates obtained from various oral niches, of a cohort of Argentinos patients with different bucodentarias clinical situations. Methods: Retrospective, transversal and descriptive study using 31 clinical isolates of oral cavity, cryopreserved and obtained from immunocompetent patients with and without periodontal disease, and presence or absence of intraoral appliances; previously recognized by conventional methods such as C. parapsilosis, and recovered for molecular characterization endpoint PCR using specific primers. Results: 100% (31/31) of the isolates were positive for Candida parapsilosis sensu stricto. 77.5% of these strains were recovered in oral inflammatory conditions, and 22.5% in terms of oral health. Being statistically significant difference (p=0). Conclusions: C. parapsilosis sensu stricto is a common colonizing the oral mucosa, especially in pathological conditions.

Keywords

Candida parapsilosis complex; Candida parapsilosis sensu stricto; Candida orthopsilosis; Candida methapsilosis; Oral niches

Introduction

Candida parapsilosis is a complex of three species (Candida parapsilosis sensu stricto, Candida orthopsilosis, and Candida methapsilosis) due to its heterogeneity genética [1].In recent years C. parapsilosis has emerged as an emerging nosocomial pathogen, and currently is the second most isolated in yeast bloodstream infections in Latin America, Asia and Europe [2]. It is the kind sensu stricto the most prevalent, especially in inmunocompetentes [3] subjects. It is known from literature that this species is the second more asylee after Candida albicans in bucal cavity [4]. In Argentina and globally are no data on the distribution and behavior of the species that make up this complex in oral niches, knowledge becomes important in the event that the mouth can be a potential source of candidemia and / or invasive infections this yeast in patients with other risk factors.

Objective

Perform identification to species level of Candida parapsilosis complex on clinical a isolates into sites oral cavity, in cohort of Argentinos patients with different bucodentarias clinical situations.

Methodology

Retrospective, transversal and descriptive study, that used 31 clinical isolates of oral cavity, cryopreserved and obtained ambulatory and immunocompetent patients with and without periodontal disease, and with presence or absence of intraoral appliances; previously recognized by conventional methods such as C. parapsilosis, and recovered for molecular characterization with endpoint PCR using specific primers (CPAR, CPAF, COOR, COOF, CMEF, CMER) [5] (Table 1), derivatives of unique sequences contained in the internal transcriptional spacer 1 (ITS 1-5.8rRNA-ITS2) ribosomal DNA fúngico [5]. Data were processed in Microsoft Excel 2010. For quantitative and qualitative analysis, Stadisticx 7.0 and SPSS programs were used; with a confidence interval of 95% and alpha error of 0.05, statistical significance considering a p-value minor to alpha error. The statistical association was assessed with chi square test and prevalence ratio.

Primers Gene Direction Species specificity Sequence Amplicon
CPAF ITS 1 Forward C. parapsilosis TTTGCTTTGGTAGGCCTTCTA  379pb
CPAR ITS 2 Reverse   GAGGTCGAATTTGGAAGAAGT  
CORF ITS 1 Forward C. orthopsilosis TTTGGTGGCCCACGGCCT 367pb
CORR ITS 2 Reverse   TGAGGTCGAATTTGGAAGAATT  
CMEF ITS 1 Forward C. methapsilosis TTTGGTGGGCCCACGGCT 374pb
CMER ITS 2 Reverse   GAGGTCGAATTTGGAAGAATGT  

Table 1: Sequence of primers used for the rapid identification at the species level C. parapsilosis complex.

Results

A total of 31 C. parapsilosis strains were recovered and molecularly evaluated in this study; obtained from different oral niches as buccal mucosa, palate, tongue and gingival sulcus. Of the 31 strains, seven were obtained from the collection of isolates of Mycology Center-UBA, and 24 came from Gandulfo Hospital (Table 2). All (100%) isolates were positive for Candida parapsilosis sensu stricto (Figure 1). 77.5% of these strains were recovered in oral pathological conditions, with clinical forms of gingivitis and periodontitis (Table 3). It was statistically significant difference (p=0); with a prevalence ratio of 3.35, which means that there are three times more likely to isolate C. parapsilosis sensu stricto in an oral cavity under inflammatory conditions compared to oral cavity health conditions (Table 4). On the other hand, 54.8% (17/31, p=0.6115) strains came from patients with prosthetic or orthodontic devices, however not statistically significant was obtained (Table 5).

Strain Source Site Species
10.2 Gandulfo Buccal mucosa Sensustricto
13.2 Gandulfo Buccal mucosa Sensustricto
15A Gandulfo Subgingival Sensustricto
51.2 Gandulfo Buccal mucosa Sensustricto
14.2 Gandulfo Buccal mucosa Sensustricto
15.1 Gandulfo Buccal mucosa Sensustricto
16.1 Gandulfo Buccal mucosa Sensustricto
23.2 Gandulfo Buccal mucosa Sensustricto
7.2 Gandulfo Buccal mucosa Sensustricto
11.1 Gandulfo Buccal mucosa Sensustricto
36.1 Gandulfo Buccal mucosa Sensustricto
53A Gandulfo Subgingival Sensustricto
40A Gandulfo Subgingival Sensustricto
12A Gandulfo Subgingival Sensustricto
50A Gandulfo Subgingival Sensustricto
50.1 Gandulfo Buccal mucosa Sensustricto
73A Gandulfo Subgingival Sensustricto
16A Gandulfo Subgingival Sensustricto
23B Gandulfo Subgingival Sensustricto
32B Gandulfo Subgingival Sensustricto
75CA Gandulfo Cheek Sensustricto
78LE Gandulfo Tongue Sensustricto
6LE Gandulfo Tongue Sensustricto
6PA Gandulfo Palate Sensustricto
4220 Gandulfo Buccal mucosa Sensustricto
4757 Micologycenter Buccal mucosa Sensustricto
5299 Micologycenter Buccal mucosa Sensustricto
5301 Micologycenter Buccal mucosa Sensustricto
5462 Micologycenter Buccal mucosa Sensustricto
6912 Micologycenter Buccal mucosa Sensustricto
7066 Micologycenter Buccal mucosa Sensustricto

Table 2: Molecular identification of 31 isolates previously defined by phenotypic methods as C. parapsilosis.

Species Gingivitis Periodontitis Oral health Total
Sensustricto 6(19.4%) IC95%:7.5-37.5 18(58.1%) IC95%:39.3-74.9 7(22.5%) IC95%:9.6-41.1 31 (100%)
Orthopsilosis 0 0 0 0
Methapsilosis 0 0 0 0
Total 19.4% 58.1% 22.5% 100%

Table 3: Relationship between parapsilosis species complex and oral clinical condition: 77.4% of the isolates were isolated in inflammatory oral conditions.

Inflamación Cpsensustricto
oral %
Presente 24 77
Ausente 7 23
Total 31 100

Table 4: Distribution of Candida parapsilosis sensu stricto according to presence or absence of oral inflammation.

Intraoral device Species sensustricto
Nº (%)
Present 17 (54.8%)
Absent 14 (45.2%)
Total 31 (100%)

Table 5: Distribution of the species C. parapsilosis sensu stricto according to presence or absence of intraoral devices.

infectious-diseases-treatment-Amplification-products

Figure 1: Amplification products agarose gel C. parapsilosis sensu stricto with primers CPAR-CPAF.
Note: Mk: Weight marker; +: Positive control; Streets 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17: Clinical samples; Streets 8, 18: Negative controls

Discussion

Of the complex, C. parapsilosis sensu stricto is the most isolated species in clinical isolates derived from immunocompetent patients both pathological conditions and such commensal [6,7]. This is knowledge that has been supported by many studies worldwide. However there are few studies reporting the prevalence and distribution of species of this complex health conditions and disease to level oral. So far it is known that C. parapsilosis sensu stricto is the most prevalent species in oral niche in conditions of immune-competence, regardless of geographic region. This has been reported studies from USA [4], Portugal [8], Turkey [9] and China [10]. While a single work in Brazil, investigated the distribution of species of this complex in oral cavity of chronic immunocompromised patients for HIV, in which C. methapsilosis was the most isolated species followed by C. parapsilosis sensu stricto, although the difference it was not statistically significant, and also the sample used was very escasa [2].

In the present study, was isolated only C. parapsilosis sensu stricto, with 100% prevalence of total recruited samples of oral cavity from immunocompetent patients. This result is similar to that reported by other authors as Ghanoun et al. [4]; Enger et al. [11]; Silva et al. [8]; Ge et al. [10]; and Tosun et al. [9] (Table 6).

Nº de aislamientos (%) porespecies
 Author C. parapsilosis C. orthopsilosis C. metapsilosis Área de origen Referencia
Ghannoum et al. 3 0 1 USA (2010) [4]
Ge et al. 2 0 1 China (2012) [10]
Moris et al. 7 0 8 Brasil (2014) [2]
Enger et al. 9 5 0 Global (2001) [11]
Silva et al. 65 0 4 Portugal (2009) [8]
Tosun et al. 2 0 0 Turkia (2012) [9]
Presenteestudio 31 0 0 Argentina -

Table 6: Distribución de especies del complejo C. parapsilosis en nichos de cavidad bucal, resumido de estudios publicados.

By relating the species found with oral clinical conditions at the time of sampling, according to data recorded in the medical history of each patient, we obtained that C. parapsilosis sensu strictodominated inflammatory oral conditions compatible withforms clinics gingivitis and periodontitis, predominating in the latter group in particular (Tables 3 and 4). On the other hand, by correlating of the isolate recovered with the use of intraoral devices, although, C. parapsilosis sensu stricto predominated in the group of patients with some form of intraoral appliances, however, the difference was not statistically significant compared to non-carriers (Table 5). There are no published data to contrast our results.

Conclusions

1. C. parapsilosis sensu stricto is a regular colonizing the oral mucosa, especially in pathological conditions. In this context, the mouth becomes a potential source of candidemia or invasive infections by this yeast; besides being a possible source of transmission for this fungus, by direct contact from person to person.

2. It’s probably that C. methapsilosis and C. orthopsilosis are two strange species in niche oral cavity under both health and disease.

3. Until now, this is the first study that studies the distribution of the species complex in oral niches in a collection of more than 20 clinical isolates, in addition, the study considers the situation dental clinic at the time of sampling, which is not seen in other reports concerning the subject.

Recommendations

It is suggested to apply the formatting of the study in a larger sample and a prospective model to validate these reported in this paper results.

Acknowledgements

The work was funded by the grant from the University of Buenos Aires UBACyT 20020120200119.

References